Bio 201 Final Review

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? – The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. – TRUE ________can convert proto-oncogenes into oncogenes. – Nonsense mutations Most human embryos that are aneuploidy – are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. – FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? – 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. – BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? – mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called – maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â €“ are on the same chromosome. An episome is – a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. – FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. – an F factor What can be inferred from an organism that has undergone a gene knockout? – The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? – identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? – G1 Certain types of cancer are caused by viruses. – TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as – both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to – get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? – random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain – All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. – FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. – TRUE Which of the following does not contribute to the infectious ability of prions? – Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? – Plant cells are totipotent. Which of the following is an advantage of molecular pharming? – The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp – base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. – FALSE A gene created from the fusion of two gene fragments is considered a – chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. – FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. – 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? – F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that – two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. – FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is – codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance – can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â €“ competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. – TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? – xeroderma pigmentosum Cancers originate from a single cell. – TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? – two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? – centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? – 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? – Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. – TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because – All of the statements given are true. Quantitative traits – are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | – 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. – TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is – a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. – TRUE Which of the following is a possible use for gene cloning? – All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? – Every band matches. What is required for a group of clones to be considered a contig? – The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? – nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be – metastatic. The process by which haploid cells are produced from diploid cells is called – meiosis In a haploid dominant species – the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that – alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? – both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? – either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called – epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. – 3,2Drugs that are HIV protease inhibitors – prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. – TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â‚¬â€œ TRUE The entire collection of a species' proteins is known as its – proteome Which of the following pollutants could be reduced with the use of bioremediation? – All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. – TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? – a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. – FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) – oncogene The formation of the bivalent during meiosis – contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. – 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. – TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. – FALSE Which of the following statements correctly describes a quantitative trait? – People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. – a sex pilus, single strand of DNA Integrase – cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? – cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage – TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. – FALSE In mammals, males are ________ and females are ____________. – hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. – 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. – cytoplasm Place the following events of bacterial transformation in order from first to last. – DNA replication b â €“ an enzyme joins F factor DNA ends c – sex pilus shortens d – DNA transfer e – an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? – plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? – They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? – tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. – two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. – TRUE The sex of all animals is determined by chromosomes. – FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? – missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? – Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that – the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission – All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. – supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? – A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. – checkpoint proteins In mitosis, the main difference between plant and animal cells is that – plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? – the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? – Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? – direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce – a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? – 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in – an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant â€Å"rescue† could have been caused by â₠¬â€œ addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? – Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? – cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone – gene amplification. All of the following are chemical mutations EXCEPT – X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? – Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is – pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? – Triple X syndrome Prokaryotes – include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to – All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. – S Sexual life cycles include both haploid and diploid stages. – TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce â€Å"Labradoodles† is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow â€Å"Texas Beauty† rose with a true-breeding â€Å"Ruby† red rose, you get all red roses. But when you cross a â€Å"Texas Beauty† yellow with the yellow variety â€Å"Jealousy,† you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? – The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? – All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins – do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because – if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. – IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because – HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in – the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? – polymerase chain reaction (PCR) Polyploidy in plants – All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, – chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because – they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? – 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? – A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.

A study of Reading Habits Analysis Essay

Poetry The theme of the poem is that trying to ignoring reality does not solve any problems. The speaker dives deeps into books to hide from his day to day problems. However, he does no benefit from this when his eyes go bad from reading. In the end, the speakers problems caught up with him and he could no longer escape from them in books. He unfortunately turned to alcohol to solve his problems. Larkin demonstrates the theme by hinting the character traits of his persona. Also Larkin uses elements such as tone, metaphors, similes, allusion and symbols to create a deeper understanding of the theme. â€Å"A Study of Reading Habits† is somewhat of dry title, but as the poem progresses, it starts to make more and more sense. The poem is about the progression of a mans life, from his childhood to his adult life. He grew up loving books because he could escape from reality. However, reading books became a habit to escape everyday hardships. But overtime the books started reminding him of his own life and he could no longer escape. In his youth, the speaker would use reading to get away from different things such as school and bullies. He did not care if reading ruined his eyes because in books he could imagine anything and escape reality. He could imagine being cool and fighting the bullies â€Å"twice my size† (line 6). Later on, during adolescence, the speaker liked reading darker books. His eyes were starting to go bad from reading so he had to wear â€Å"inch-thick specs† (7). He enjoyed the evilness of his books. With his â€Å"cloak and fangs† (9) , he would have sex with women and humiliate them . Now, in the present, the speaker doesn’t read anymore because the stories are too closely related to his issues. He can no longer escape his problems regarding his lousy life. As a result, the speaker condemns books altogether stating that they â€Å"are a load of crap† (18) and turns to alcohol to resolve his problems. He recommends to â€Å"get stewed† (17) instead of reading. The speaker in this poem speaks in first person. The imaginative person envisions a fantasy world where he could be cool and â€Å"deal out the old right hook† to his bullies (5). The speaker is also lonely. In the final stanza the speaker realizes that he doesn’t know how to face reality. His whole entire youth was created through fictional books and now the more mature  books, highlight his lonesome. Additionally, the speaker is resentful. During his childhood, books were of so much value to him. They were worth â€Å"ruining my eyes† (3). But the books in that time were fictional, and most likely of superheroes and other fictional idols. Later on, the speaker realizes he is not equipped for reality and believes â€Å"books are a load of crap† (18). The speaker’s tone is disappointed and bitter. There was a smooth, euphonic quality to the words in the beginning stanza. This emphasized how easygoing and fantasy-like childhood can be. Also, there was alliteration in line 6. The text â€Å"dirty dogs† was symbolism of the persona’s bullies. This alliteration illuminated upon the name calling present in youth. Additionally, the poem contained a rhyme scheme within stanzas. The poem is about the speaker’s life progression. Each stanza represents a different stage in life. The first stanza represents his childhood, the second stanza represents the speaker’s adolescence and in the final stanza the speaker comes to terms with reality that he can no longer hide behind books. He realizes that his world is less fulfilling than the fantasies portrayed in books. He feels betrayed by books and his tone becomes bitter. As the speakers life progresses throughout the stanzas, his views on books become contradictory. The very first line in the poem pertains to the speakers’s love â€Å"of getting [his] nose in a book† (1). On the contrary, the final stanza represents the speaker’s new feelings towards books. Compared to the first line, the very last line states that the speaker believes books are a worthless â€Å"load of crap† (18). In this poem Larking uses literary devices such as a metaphor and a simile. The line â€Å"the chap who’s yellow and keeps the store, seem far too familiar† (15-17) functions as imagery. The speaker is characterizing the character is his stories as the color yellow. The color yellow has negative connotations such as cowardice, faithlessness and betrayal, which is exactly how the speaker is feeling about his book at this stage in his life. This metaphor produces the effect of a cowardly or faithless character, who evidently relates to the speaker. The authors use of a simile is also  present in the poem. The simile is obvious in line 12, where the speaker talks about how he thought of women. He did not think much of them and â€Å"broke them up like meringues† in his fantasized worlds. He compares women to meringues, a light, airy, sweet desert. This simile functions as his desire for sexual encounters with women. The poetic device of allusion is also evident in the poem. Allusion is created in the second stanza when the speaker makes the allusion to vampires when describing his interest in dark fictional books. The words â€Å"cloak† and â€Å"fangs† function as characteristics usually related to vampires as well as the word â€Å"sex†, representing his sexual maturity. The speaker’s taste in fictional text matures, along with his sexual interests. Symbolism is evident in the poem. The most obvious symbolism is the poem structure itself. The poem is three stanzas long, each symbolizing a different stage in his life. The first stanza is clearly represents his childhood. The speaker has typical childhood bullies and his tone even seems to be that of a child. As a kid, he reads escape these bullies and to feel better about himself. The second stanza represents his adolescence stage in life. The speakers tone is much more mature and dark as he talks about evil and sex. He also admires the symbol of a vampire and has a stronger sexual drive. Finally the last stanza symbolizes his later years. He starts to realize that he cant escape his problems anymore and even relates himself to the weak characters in his books. Also symbolism is evident when the speaker describes the books he dislikes during adulthood. Lines 13 to 17 talk about characters in books that are cowards or fall short. In line 17, the speaker is uncomfortable with these books because the characters â€Å"seem far too familiar†. The characters in these books function as symbols of the speaker and his lousy life.

AutoTextList s NoStyle tPlease enter the titl Essays - Economy

AutoTextList \s NoStyle \t "Please enter the title of your essay here. Remember that all major words should begin with a capital letter. Also do notbold, underline, or italicize your title."Case 11-3 BudgetAutoTextList\s NoStyle \t "Please type in your first and last name"Tara JohnsonAutoTextList \s NoStyle \t "Type in your name name and number and then give the course title. For example, ENG 121: English Composition I"INF 336 Project ProcurementAutoTextList \s NoStyle \t "Enter your instructor's first and last name here. For example, Prof. Emily Nye"Abbie BellerAutoTextList \s NoStyle \t "Enter the date you will submit this assignment. The date should go Month Day, Year. For example: January 2, 2014"December 11, 2017 Case 3-11 BudgetOrganizationsgo through many changes within the organization due to outsourcing, eBusiness and with the increase of globalization. Supply management and purchasing are considered hair raisers in any company and it is a major concern for the purchasing manager who must maintain and adhere to a budget. Service focused businesses are beginning to dominate major economies. When a company is marketing a product, it is their job to ensure that the product iscompelling, the companyalsoneeds to have the manpower to handle the workload of producing the product at an attractive price.Companies must recognize purchasing as supply management if they are going to remain competitive. In market transactions the price of the goods or service is determined by supply and demand in the market.Tocreate aprofit,the purchase price should be lower than the selling price. When we look at the example ofCase 3-11 Carmichael Corporation, they needed the product MS-7 but would it be worth it in the end to purchase it? The price of the MS-7 had greatly increased and that could cut into the company'sprofitability. At this point, they canconsiderother products that are cheaper but produce the same results. This is where strategic cost management comes into play. When a companyunderstandcosts that support their strategic position and which costs have either no impact or weakens it, the goal isto reduce the total costs while improving the strategic position of the business. Before Amanda Tellford, of the Carmichael Corporation decides to cut corners she needs to understand that cost is a strategic issue and should be looked at in the long term. She really needs to get a better understanding ofhersuppliers and their business and somehow help them toimprove their processes and with the end goal of loweringthe company's costs.Her business and the product that they market are unique.Since Brisson is planning to corner the market, I feel that she probably will be better off if she joined forces with Brisson. The MS-7 that her company needs will be made locally within the US and even though the price might be higher than what she's used to the product turn around should be quicker. It is not in the best interest for her company to try to manufacture the product themselves because they don't know how well the product will do in the future months. So, let Brisson make the initial investment and as the market grows and gets stable then the Carmichael Corporation can make and manufacture their own MS-7. But, on the other hand if everything busts and it's a failure they are not out of any money. She needs to keep in mind the learning curve and man hours that it will take to manufacture the MS-7 and to make a huge investment like that when you are not sure is notbusiness smart. The companyshould all concentrate on the need to provide the best products to their customers as a wayof beating or remainingcompetitivein the market rather than over concentrating on what other companies are doing (Weele, 2010).Amanda will waste precious time and resources worrying over things that can't be changed. Deliver a superior product and have good service and the customers will come. Even if

LPN to RN Transitions Essay Example | Topics and Well Written Essays - 750 words

LPN to RN Transitions - Essay Example Registered nursing is at the top of the nursing team. They are holders of a degree or a three-year diploma course. Registered nursing have expanded duties in the field but their main role is taking care of the patients and ensuring that patients are living in a safe and a healthy environment. Another role is taking orders from the head of the nursing staff and assessing the patient’s condition by coming up with a plan to take care of a patient. The care plan is determined by many factors including the age, sex, religion, dietary needs and the willingness of the family support. Registered nurse is also responsible for triage, a practice that determines which patients should receive treatment first based on the showing symptoms and major complaints. Nurses with Bachelor’s Degrees have greater opportunities in the careers as they are involved in research programs in the nursing field that helps in promoting effective health care in the community and in health facilities. As such, the registered nurses are also involved in nursing science, which entails scientific research in health care (Dreher, 2011). Leadership role in Registered nurses ensures improved health care in patients and helps nurses in acquiring essential skills and abilities required in the health system. For instance, carrying re-education projects to improve the effectiveness in nursing. LPN nurses also referred to as vocational nurses have about a year in the nursing school to attain a certificate in the field. LPN nurses can perform most RN duties but they assess duties as directed by the physician. LPN role ranges from giving medication to patients as directed by the physician, injections and immunizations, entering data in the computer system, taking medical history, checking crucial sign encompassing temperature and high blood pressure. They are also responsible in checking wound care, which include cleaning and bandaging an injury.

Business ethics as contemporary management topic Term Paper

Business ethics as contemporary management topic - Term Paper Example The study has selected business ethics in order to understand following learning outcomes: Many companies (read Nortel, Enron, Layman Brothers and others) have suffered the ill effect of poor business ethics in last two decades hence discussing contemporary issues related to business ethics can help the author to gain knowledge about organizational sustainability. Business helps the organization to build sustainable representation in front of their stakeholders. Unethical business practice creates a negative impact in the mind of both shareholders and stakeholders. In many cases, it has been observed that government of a particular country takes legal action against organizations practicing unethical activities such as bankruptcy, fraud, misrepresentation of financial asset or fraud. Legal action against unethical organizations not only perturbs sustainability of them but negatively impacts shareholder’s interest. Studying business ethics will help the author to understand the importance of organizational sustainability in terms of financial perspective. Many companies of USA have understood the importance of business ethics hence they have created ethical assistance lines for stakeholders to report the ethical concern about the business practice to them. The following diagram will show an increase of concern related business ethics in recent times. There is a vast gap between ethics and self-interest in the business practice. Many business executives emphasize on self-interest in order to fulfill personal prosperity instead of doing business for the betterment of society.

Geographies of war, occupation, resistance, and terrorism Essay

Geographies of war, occupation, resistance, and terrorism - Essay Example Unlike Britain and France, the major European powers, the US were highly recognized by Middle East as a good country with good people. Some of the key factors that improved US image in the eyes of the Middle East countries include the introduction of up-to-date medicine initiatives in the region, establishment of educational institutions, and provision of qualified petroleum engineers. As a result of the contributions of the US made in Middle East, the two regions had a strong connection prior to the Second World War. However, in the recent past, the two regions had a negative relationship that had triggered political unrest. This paper seeks to analyze the causes and solutions of the conflicts between Middle East and US. Even though Arabs and Israel have been involved in conflicts for a long period of time, the vested interest of the foreign countries, also referred to as foreign elite, has triggered the violence that led to large number of deaths in the Middle East countries. In ad dition to the US, China, Britain, Germany and Russia have also focused at controlling the oil in the Middle East countries. It is worth noting that as long as the foreign elite continue to be involved in the Middle East politics, the conflicts will remain unresolved. ... According to the Arab countries, US is the major cause of the conflict based on its political suppression, occupation of native land, military invasion as well as continued support of Israel on its political suppression against Palestine (Wu Sike 15). Additionally, Middle East countries argue that the US have negatively affected the culture of Arab countries by bringing about western values that have sabotaged the significant values of Islam community. As a result of the US invasion, the radical in the Middle East have gone to the extreme in their endeavor to resist the US control resulting to the emergence of terrorism. Another major cause of the animosity between the US and Middle East is the aim of the former to control the Middle East oil. In their efforts to expand their oil reserves, the US and other powerful states interferes with Arab-Israel conflicts with an aim of controlling the vast petroleum resources that acts as the major source of income for the Middle East countries. As a result, Arab countries have joined together to attack US interests in their countries such as the embassies, diplomats and other expatriates. In their efforts to improve their economy and intensify their control over the Middle East foreign countries have continued to sell weapons to the Arab countries an aspect that instigated conflicts in the Middle East. In this regard, it is fundamental for the UN and other international organizations to ban the sale of weapons to the Middle East countries to eliminate the war that has decapitated the economy of the Arab countries. Morris (37) argues that the emergence of corrupt and poor leadership in Middle East is one of the

How to write a catchy beer ad Essay Example | Topics and Well Written Essays - 500 words

How to write a catchy beer ad - Essay Example Ballard tells of the search for a memorable phrase, a hook that would catch on like the memorable ads that we always associate with a brand name. The music that the team of Evanston and Godsey provided seemed the perfect match with the simple phrase "...and twins". The advertisement was centered on the things guys like and was highlighted by the addition of sexy, buxom twins. The author explains the ads success is based around the simple beginnings of what guys like, accented by good music, and produced with humor. Ballard contends that it was the humor that set this advertisement apart from dozens of others and catapulted the twins into our pop culture memory. If rule number one in advertising is to know your audience, Coors Light hit a home run with this spot. The advertisement in inundated with the things that their target age group finds appealing. It relies on cars, sports, dogs, humor, and the concept that two is better than one. They were able to mesh these ingredients into an advertisement that would quickly be associated with beer. Coors was also able to handle the political correctness of sex in advertising with their attitude of using sexy not sex to sell their product. By adding enough light humor, just enough to make the guys appear a little silly, they were able to deflect the issue of women as sex objects and warrant the ad acceptable to women and girlfriends. Advertising, as a science, dwells on peoples response to an image or sound in an effort to portray things that are pleasant and appealing. The pictures need to be something we are compelled to look at. The music must be memorable, with a hook that echoes in your head days after you hear it for the first time. In addition, the advertiser needs to keep in mind the target audience while not offending the innocent viewers who may be able to influence the customer. The

Come up with topic and I will discuss it with the professor then u can Essay

Come up with topic and I will discuss it with the professor then u can start writing - Essay Example Corporate income tax depends on the net taxable income. Where taxable income surpasses $335,000, all taxable income is subject to tax at 34 percent or 35 percent. Tax rate enforced below the federal level fluctuate from 1 percent to over 16 percent. Regulated Investment Companies (RICs) are the domestic corporations which during the taxable year are listed under the Investment Companies Act of 1940, as amended as a unit investment trust or a management company or to be treated as a business development company under such Act. This paper will focus on tax treatment of regulated investment companies and the corporate income tax and how do they differ from one another. Historical Content During the past decade, the corporate income tax has been the centre of attention of much debate and criticism in the United States (U.S.). It may be due to the low level of business investment in US and it has been also condemned as a primarily illogical and unfair tax because corporations are taxed as independent entities, in spite of the tax brackets of individual shareholders. The recent tax acts have lessened the corporate tax burden by substituting the system of several asset depreciation classes with three capital recovery classes. Business structures can be written off over fifteen years, other equipment over five years and light equipment over three years (Auerbach, 451-458). The corporate tax is the 3rd major source of federal revenue after the payroll taxes and the individual income tax. Regulated Investment Companies are listed under the Investment Companies Act of 1940. RICs escape corporate taxes due to the reason that they make profit from investments through shareholders and they do not have any real operations. Thus, they pass profits to shareholders and circumvent double taxation. They meet definite standards and therefore do not have to pay federal income taxes on interest, distribution of dividends and realized capital gains. Economic Incidence of the Policy Sh areholders must be the citizens or residents of United States. The tax is imposed on the profits of the resident corporations of U.S. at graduated rates ranging from 15-35%. Corporate shareholders pay individual income tax on capital gains and on dividends from sale of their shares. The corporate tax rules which are faced by the U.S. based corporations on their profits from United States business activities, of which the foreign multinational companies are the owner, are same as that of U.S. owned companies. An increase in the corporate income tax increases the cost of capital in the corporate sectors due to the burden of tax-wedge. The return to corporate capital falls as capital flows from corporate sector to non corporate sector. For high capital intensive industries, corporate income tax increases the prices of goods and services and for low capital intensive industries, prices falls with the tax. U.S. capital bears the small incidence of the corporate income tax and labour bear s more or less 100% of the incidence of the corporate income tax. The domestic corporations who bear the economic incidence and therefore opt to be taxed as a RIC are as follows: RIC must be a corporation which should be registered under the Investment Companies Act as a unit investment trust or as a management company. It may also be a common trust. Each series fund which is ascertained by a RIC will be treated as a separate corporation and they should separately meet all the qualification

Is music an entertainment or art Essay Example | Topics and Well Written Essays - 1000 words

Is music an entertainment or art - Essay Example   Ã¢â‚¬ËœIs music an art form or entertainment?’ is a difficult question for one to answer. Art is related with self-expression which reveals the creativity of a person while entertainment is based on public enjoyment. In a case of music, it needs artistic qualities as well the elements of entertainment. Considering the popular music culture during the 1960s and 1970s in English speaking world, one can find a brilliant amalgamation of art and entertainment. Historians have documented that the event of Civil Right Movement and the associated civil disturbance and the Vietnam War greatly influenced the youth culture. Formation of life style, values, and economic growth of youth marked the influence of these two happenings. Newly originated popular culture in which rock/soul music was the dominant one which changed lives. People from the English speaking world receive this cultural division of sex, race and began to see each one having different perceptive. Here, one can see th at popular acceptance of rock/soul music underlines the presence of both artistic features and some characteristics of entertainment. The new popular culture during the 1960s and 1970s marked the emergence of rock/soul music which provides some features of entertainment as well the characteristics of art. As a medium of entertainment, music requires a perfect content which describes the social and cultural heritage of the nation, brilliant instrumentation, and effective visual presentation. The song entitled, â€Å"Ain't Nothing Like the Real Thing" by Marvin Gaye and Tammy Terrell gives a particular beat style which promote a faster track than rock. Motown uses little bits of melody in its songs. Similarly, the frequent use of electric keyboards in Soul music gives a different experience for the listener. Social and cultural backgrounds The content of Motown music is matured and diversified which performed great artistic value. Research professionals mention that Motown became the centre of popular music in sixties and one can easily find its strong influence of African American or gospel backgrounds. Here, the lyrics of the songs need both artistic quality and some features of entertainment. The song â€Å"I heard it through Grapevine† by Marvin Gaye gives higher level of artistic performance as well entertainment quality. Michael Campbell and James Brody observe; â€Å"It is beautifully integrated: every elements blends shamelessly to convey the sense of the text which gradually unfolds the story of love gone wrong† (Campbell & Brody 185). In case of popular music in the English world, one cannot find the crisis between the features of art and entertainment in music. Music of Motown and Soul underscore the contribution of Black people or African Americans. Various use of instrumentation affects public acceptance and popularity. It is significant for a reader to notice that the songs of Bob Dylan and Motown give considerable status in lyrics. Considering the song entitled "The Times They Are A-Changin' (1964) by Bob Dylan, one can find that the Dylan gives more emphasis on its lyrics than music. The song is based on political movements of that period. The sufferings of and protest of working class people is revealed through his words. Even without a band and or any other instrument listener/viewer can get the feel of an anthem. Therefore, popular music culture in 1960s and 70s concentrated artistic features than entertainment. In case of music, songs of Motown and Soul acquired great popularity among the public because of its music and instrumentation. Artists have controlled the use of the elements of entertainment in their songs. Visual presentation and class identification are is not a significant matter among the public in

Summary of a book chapter Assignment Example | Topics and Well Written Essays - 500 words - 8

Summary of a book chapter - Assignment Example Precisely, this means that there is a ‘rising importance of religious beliefs, practices, and discourses in life,’ which has signiï ¬ cant inferences for international relations (Thomas 2005: 26). Religion and politics are profoundly intertwined in the ancient days, unlike the modern world where these elements stand as independent entities. Medieval authority spread among a chain of command of religious and political rulers. When the Thirty Years War in Europe (1618–48) was over, a new modern era presaged the liberation of European leaders from the religious–political authority of Christendom. Power and authority became concentrated at one point. Although religious beliefs were disgorged from the political life, religion still inï ¬â€šuences the political agenda in many countries. Policy and issues approach seeks to prove that in an anarchist world ‘states have a hierarchy of interests. Specifically, the pattern occurs with security at the top, followed by economic welfare, and then the ideological and humanitarian concerns at the lowest level (Desch 1998: 160). Some theorists believe human economic and social activity is taking place in a way that portends some form of deindustrialized society (Lee 1993). The anthropocentric and Judeo-Christians argue that man exploits nature in pursuit of human destiny and development. Notably, this is different from an eco-radical worldview that puts an equal value of humans and nature (Eckersley 1992; Goodin 1992). Eco-radicals contend that the state is the cause of the environmental crisis (Carter 1993). Nevertheless, there is no agreement about the role of the state or its alternative. Consequently, this brings the current debate on the scope and depth of necessary reforms for facing the environmental challenge. The New Patterns of War and Peace approach claims that armed conï ¬â€šict takes place within

Report on the Film “Black Cat, White Cat” by Emir Custurica Essay Example for Free

Report on the Film â€Å"Black Cat, White Cat† by Emir Custurica Essay have chosen to watch and report on the film â€Å"Black Cat, White Cat† by Emir Custurica for several reasons. Firstly, Custurica is a globally famous filmmaker, known in the US for his â€Å"Arizona Dream†. Secondly, Custurica does pay much attention to matters of culture in his films, so his works are very informative. Thirdly the characters of â€Å"Black Cat, White Cat† belong to different peoples and cultures, including Serbians, Gypsies and Bulgarians. So the film tells enough about cultural and cross-cultural communications. Produced in 1998, the film is a kind of romantic comedy telling a story of several young people in search of their love in the world of gangsters and smugglers. One of those smugglers named Matko Destanov owes money to a gangster named Dadan. Dadan is eager to find a husband for Afrodita – his midget sister and he proposes to settle the debt by marriage of Matko’s son Zare with his sister. However, Zare is in love with another girl named Ida, and Afrodita dreams o another man. After numerous funny and dangerous adventures all of the young people find their happiness, and Dadan finds himself in manure both in metaphorical and ordinary sense. The film is very ironic and easy to watch as a family comedy. As I have already noticed, the film tells much about cultural communications. Firstly these are family and friendship. The characters seem to be very family-oriented and â€Å"beautiful friendship† is one of the core motifs of the story. Young people dream of a family and stable relationships, older people desire to make their children happy as Zare’s grandfather and even such a savage man as Dadan wishes to do the will of his parents even though through violence. Personal relations are basic forces driving the characters in life, business and even crime. They rely upon help of their pals and relatives in virtually every action they take, thusly playing a tricky party game – each for own purposes but considering the will of the others. This can be illustrated by relations of Zare with his grandfather. Zare loves his grandfather and helps him to escape from hospital to return to his bacchanalian lifestyle, and the thankful grandfather gives all his money to Zare. Such approach to personal relations is full of traditionalism and is pretty different from the present situation in this country. Another cultural aspect, which might seem rather evil in this country is attitude of characters towards law. Throughout the film it may seem that there is no law and legal formalities at all. Customers are easily bribed, medical personnel is unable to control the patients, gangsters behave as actual rulers and an official solemnizing a marriages passively does everything what he is ordered to do, even knowing that marriage between Zare and Afrodita is forcible. However, the characters actually do not feel any discomfort from absence of formalities. Law is replaced by aforementioned personal relations, and perhaps they would feel unhappy from presence of legal obligations rather from absence of such obligations. There are many interesting minor cultural details in the film such as marriage customs, costumes, language features and other which, being combined together, create a fascinating impression of involvement in other culture. Films like â€Å"Black Cat, White Cat† cause spectators to become interested in strange lifestyles and habits forming an idea of global cultural diversity.

The Acropolis Essay Example for Free

The Acropolis Essay The Acropolis is the main part of the city of Athens located in 150m above sea level. Since ancient times, art flourished in his part of the city. Temple building had both a symbolic and economic objective. It glorified the gods and the city, which thereby succeeded in overawing the proprietary aristocratic cults that existed in the earlier foundations. In economic terms temple construction meant returning to circulation the money that otherwise would have accumulated in the coffers of the divinities concerned. Acropolis represents a flat-topped rock settled since Neolithic era (6 millennium BC). Further, Mycenaean population settled in this region. In two centuries, Acropolis was occupied by Kylon. For tribes henceforward all looked alike to Athens, set on that plains broad level between the mountains and the sea (Coulton 34). The splendid rock, the famous acropolis, afforded them a strong, capacious citadel; and under the rocks north slope sprang up the nucleus of what later was to be incomparably the largest of Greek towns. Political power was vested in the hands of a landowning aristocracy, the High-born or Eupatrids. From their ranks were yearly chosen the three Archons or executive officials, for civil administration, for religion, and for war. Plutarch, in his life of Pericles wrote of the great Classical buildings on the Acropolis that â€Å"they arose no less towering in their grandeur than inimitable in their grace of form, for the workmen eagerly strove to surpass one another in the beauty of their craftsmanship . . .† (Berve 56). This description shows that Acropolis had a great meaning and significance for Greece.   Acropolis art included literature and sculpture, buildings and painting. The most famous architectural constructions, temples, were located in Acropolis’ slopes. The most important temples were the Parthenon, the Erechtheion, and the Temple of Athena Nike. Temple sacred to Athena Polias’ was built around 6th century BC. There were two temples of Athene, an old and a new. Athenas new temple on the acropolis, and the great Portico which was raised at the entrance to the hill; out of it, too, came the gold and ivory statue of the goddess which stood within the shrine. Such a use of the allies money may seem inexcusable to us; but the ethics of imperialism are never very easy to define. Pericles believed that Athens had a mission to spread artistic culture by such means, and for this reason empire builders too have believed in their own mission and not always in a mission upon so lofty a plane (Berve 67). The temple of Athene had important meaning for Greeks because the climax of the Festival was a procession of ascent to the temple of Athena on the citadel. This temple dated from times long before the tyrant Gelon, there is excellent evidence that he embellished it, adding perhaps the pillars which ran round the shrines exterior, and the sculptured groups of marble figures which adorned its gable-ends. Nor were these the only monuments of his architectural passion (Coulton 76). Peisistratus and his sons rebuilt the Ancient Temple of Athena, with a peristyle of stone. Most unusual is the difference of material in the marble raking cornice, with its hawksbeak bed moulding and a crowning moulding which, though an ovolo, is also painted with a Doric leaf. The sima is likewise of marble, and on the pediments has the ovolo imitated from Corinthian terracotta simas, but on the flanks it retains the old Ionic vertical face with pipe-like spouts at intervals, while the water-spouts carved on the four angle acroterion bases were lion heads at one end, ram heads at the other (Berve 9). For the first time great pedimental groups were carved in marble, and consequently in the round rather than relief, for the technical reason that it was cheaper to construct the tympanium background separately in local limestone; the subjects were, at the east the battle of the gods and giants, and at the rear a combat of animals. The Erechtheum (421-407 BC) was constructed, near the north edge of the Acropolis, in the troubled period after Pericles death when the Peloponnesian War was going badly for Athens and funds were limited. Despite these handicaps, and the extraordinarily difficult architectural problems involved by the necessity of incorporating earlier shrines into the structure, the Erechtheum ranks as the finest of all Greek temples in the Ionic style. It later suffered badly from fires, from adaptation into a Church and then into a Turkish mansion, and from the carrying off of much of its materials for use in medieval and later buildings. This temple had â€Å"porch of maidens† consisted of six female figures as columns (Plommer 34). The greatest temple, the Parthenon (5th century BC) and popular monument, the Propylaea, were in the Dorian style, though they were in many respects different from the Dorian works elsewhere. Leader among the architects was Ictinus, the designer of the Parthenon, Ictinus was assisted in his work on the Parthenon by Callicrates, of whom less is known; and the name of Mnesicles has come down to us as that of the creator of the Propylaea, the Parthenon embrace both Doric and Ionic principles, as well as their distinctive features.   This temple was built on the place of the old temple of Athena. A huge platform of solid limestone masonry 252 feet long and 103 feet wide, attaining at one corner a height of 35 feet above bed rock, â€Å"formed the substructure of the temple; along the south flank it was intended to form a podium rising 7 ½ feet above the graded earth† (Berve 34). Leaving a portion of the platform to form a terrace on all four sides, the three-stepped temple was begun with stylobate dimensions of 77 feet 2 ½ inches by 219 feet 7 ½ inches; the lowest step was of pink Kara limestone, the middle step and stylobate of Pentelic marble. The temple was hexastyle, with sixteen columns on the flanks, all uniformly 6 feet 3 inches in lower diameter except those at the corners, which in accordance with a new system of emphasis were thickened by one-fortieth of the diameter. On the other hand, the archaic practice of reducing the flank spacing was retained. The inner building was tetrastyle prostyle (rather than in-antis) at both ends, the antae being of Ionic form lacking offsets but with base mouldings which were continued along the cella walls (Berve 56). The pronaos gave access to a long cella divided by two rows of interior columns, while through the opisthodomus could be entered what was probably a single large room, the prototype of the west chamber of the Periclean temple (Dinsmoor 48). The chief interest of this temple is that it initiated marble construction in Attica on a large scale, introduced the use of Ionic elements (Ionic frieze which runs around the walls) and the application of delicate refinements in upward curvature and column inclinations, and even contributed much of the material and many of the dimensions for the present Parthenon. When the Persians returned in 480 B.C. they completely destroyed it, the unfinished columns at this time having attained a height of only two to four drums above the stylobate. Also, â€Å"in high relief 92 metopes were carved† (Dinsmoor 48). East and west impediments depict scenes from Greek mythology. â€Å"The metopes of the Parthenon all represented various instances of the struggle between the forces of order and justice, on the one hand, and criminal chaos on the other† (The Parthenon, n.d.).   Pheidias was the maker of the celebrated gold and ivory Athena Parthenos that stood in the Parthenon. There are literary descriptions of this lost statue which inspire us with the belief that the great image was truly free in the Greek sense. There are also, unfortunately, copies of Roman date which can only mislead. When he made the Athena Parthenos in Athens, and later the seated Zeus at Olympia, both of gold and ivory and on the giant scale, he was fulfilling the highest ambition of Greek art which had begun, more than a thousand years before, to make works of ivory and gold (Coulton 74). Under the south-east side of the Acropolis he further planned the building of a magnificent temple to Olympian Zeus. This scheme he never lived to see completed; and before the roof was added, the Athenian people had regained their liberty. The gaunt columns of the arrested work were left simply as they stooda memorial, as it were, of the tyrants frustrated pride and a warning to others who in future days might be tempted to follow in his footsteps (Coulton 73). Similar plans were employed for the earlier temple of   Ã¢â‚¬Å"A† on the Athenian Acropolis. More elaborate was temple A on the Acropolis, with a tetrastyle in-antis faà §ade (Plommer 78-80). In these temples may be seen the characteristic Greek practice of using a different type of anta capital (with the Doric) from that of the column In the entablatures, while the mainland tendency was to leave the metopes uncarved, they were frequently accented by the use of thin slabs of white marble, contrasting with the dark blue or black of the triglyphs and the blues and reds of the taenia below and cornice above. The Hydra gable (belonging to an unknown building on the Acropolis) illustrates the growing Athenian tendency to use sculptured pediments, though here the amount of relief is only 1 inch (Plommer 78-80). Other Athenian temples of this period were the miniature temple E on the Acropolis, unknown as to location (possibly one of three treasuries, including temples B and C, west of the Hecatompedon) though its details obviously imitate those of the Peisistratid temple of Athena, and also its direct antithesis, the huge but frustrated beginning of the great Olympieum by the sons of Peisistratus, abandoned when Hippias was driven into exile in 510 B.C. (Plommer 78-80).. The two lower steps were actually built, as well as the foundations of the second or inner rows of columns, as well as the arrangement of the columns, the outer rows having eight on the fronts and twenty-one on the flanks, with a diameter of 7 feet 11 1/4 inches (Dinsmoor 48). The Acropolis and its temples embodied the best architectural constructions of Ancient Greece. The Acropolis temples represent a architectural importance because of the meticulously detailed representation of a building and unique combination of styles. Works Cited Berve H., Gruben G., Hirmer M. Greek Temples, Theatres and Shrines. Greenwood Press, 1963. Coulton J.J. Greek Architects at Work. Cambridge: Cambridge University Press, 2002. Dinsmoor W.B. The Architecture of Ancient Greece. London: Croom Helm, 1975. The Parthenon n.d. 09 Ma7 2007. http://academic.reed.edu/humanities/110Tech/Parthenon.html Plommer W.H. Ancient and Classical Architecture. Cambridge: Cambridge University Press, 2001.

Main Market Segments In Egyptian Market

Main Market Segments In Egyptian Market Introduction Paul founded 120 years ago and is a market leader in France with more than 360 local branches and has spread over 20 countries worldwide. Its a private sector company operated under HOLDER group which its 3 businesses are bread-making, pastry and restaurants. Pauls well known across its borders, and Egypt is one of its targeted countries as its further developing, nowadays. Through our frequent visits to various spots in different cities in Egypt, we noticed how life style is developing encouragingly; we had to be certain about how liable our projected sales would be in this market. Accordingly we had assigned a marketing research to an international marketing research company TNS Global which had been for decades present in Egypt. By this we could ensure more accurate estimated results with first-rate standards. TNS Global has provided us with the primary data through statistical research. We agreed upon that to follow the marketing research through the following steps. a) Defining Problem and research objective. Our main goal is to ensure the feasibility of entering the Egyptian market, and thorough which means. b) Developing the research plan. We needed to focus on adults and students as a primary target, athletes and healthy people as secondary target children and seniors as tertiary target, without neglecting business targets as well. The research needed to cover the following information: The demographic, economic and lifestyle characteristic of these segments. Main market segments in Egyptian market Perceived price for our products by Egyptian consumer Suitable market entry Preferable sales approach Acceptance of the Egyptians for French products -Egyptian consumer behavior and buying rhythm Suitable product features (size-packaging-colors-labeling) Competitors (local-international) Legal and social environment in Egypt Raw materials-labor cost and other production cost if we consider producing locally Investment rules in Egypt online commercial databases, we emphasize the primary data through our research to guarantee its validity and objective conformity. Our primary data collection will use survey research approach c) Sampling plan. Random sample questionnaire is used to ask people, on our product and on the idea itself and how they react to it and how much acceptable for them it would be and such open-ended questions. To put hands on required information for research objective. d) Implementing the research plan. TNS Global had feed us with implantation that includes collecting, processing, analyzing the information. e) Interpreting and reporting the findings. Conclusions were sent to us in a vivid form that assured our idea about the viability and investment of our product in the Egyptian market. Part B Executive summary Paul is preparing to launch one of its branches in Egypt, which is one of the big developing markets. Through direct investment to insure our control over the Egyptian market. Despite the presence of bakeries other competitors, we can compete because our offering combines both high distinctive quality and suitable market price. We are targeting special segments in the consumers level, taking advantage of high quality baked goods, and distinctive foods and desserts. The primary marketing objective of this research is to obtain first year Egyptian market share of 20 %. This primary financial objective is to achieve first year sales revenue of 20 million EGP, while keeping losses to less than 6 million EGP. Current Market Situation Paul founded 120 years ago and is a market leader in France with more than 360 local branches and have spread over 20 countries worldwide , and is about to enter the Egyptian market directly . The demand of the Egyptians to cafes with baked goods is increasing rapidly which lead to increase in competitive pressure. Thus dependence on high quality and a little over price according to other competitors will be obligatory to reach market share in this environment. Paul must carefully target specific market segments. Market Description Paul market consists of consumers of all ages from young children up to seniors which could be athletic , healthy or food admiring , who needs a quick pick and go or a short break in regular daily basis . In the first year we will focus on specific segments. Table A1 illustrates how Paul covers the needs of targeted consumers Product Review Paul offers various high quality standard products indoor where customers can have ability to connect via the Internet while enjoying leisure or meeting or takeaway: 7 Plates specially for breakfast 6 Varieties of plates for a quick lunch 24 Different sandwiches with the variety of 7 different breads 10 Types of pies pizzas 15 Salads 8 Grand classic bread 10 Pleasure bread 8 Light and healthy bread 4 Special meals for athletic and Healthy people 11 Different types of cakes and desserts 5 Type of ice creams 9 Viennoiseries and sweet pastries 6 Options of Crepe 36 Fresh juice , Hot and cold drinks 7 Take away boxes of 12 mini special desserts of ones choice Table A1: Target Segments Customer Need Corresponding Benefit Children Sweets Desserts Macaroons Cakes Tarts Ice creams Students Quick pick and go before classes Small snacks on way back home or between courses Sandwiches Viennoiseries Hot and cold drinks Salads Adults A little gathering between shopping, work or hangouts A quick drink on busy days Breakfast or lunch plates Fresh juice or other drinks Crepe Pies and pizzas Seniors Buy goods for home or family One of the 22 Bread A box of mini desserts Athletic and Healthy Healthy low fat food Food to fit in their daily diet A grab before or after workout One of 8 types of the healthy breads with minerals and vitamins The unique collection of the healthy sandwiches One of the meals for athletic people depending on their activity and their daily need First year sales profits are expected to be 20 million EGP based on sales of Pauls baked goods. During the second year we prepare to introduce Pauls restaurant which will provide the following: Soups Side dishes Side sauce Big main dishes for Breakfast , Lunch Dinner More menu variety from each category of the previous provided products Competitive Review Increased entry of cafes and bakeries has pressured competitors to continuously let prices down and add more products every day. Competitors include: Starbucks Costa coffee On the run The bakery Starbucks: Is an international coffee shop from 30 years ago, offering hot and cold drinks, some desserts and very few sandwiches. Costa cafà ©: is a 28 years old coffee shop which is internationally recognized, that offers few sandwiches, salads and desserts. But recently is facing financial struggles due to the increase of competitors and being not able to provide a bigger variety of products. On the run : is the biggest competitor as its widely branded through almost 9000 stores worldwide , and one of the leading stores locally .It sells desserts , sandwiches, hot and cold drinks , salads , very few pizza. The bakery : is one of the several shops which is considered to be a cafà © and a bakery that sells some bread , sandwiches , few desserts , hot and cold drinks Despite this strong competition, Paul can make out a distinct image and win recognition between these competitors and targeted segments. Our Unique way of baking bread is definite and doesnt exist anywhere else , adding Pauls large variety of products which have French background makes it unique in the local market , and never disregard 120 years experience. Distribution review Pauls products will be sold through Pauls stores and also through other stores in top 20 Egyptian markets. Among the most important partners that will help us distribute that already has been contacted are: Super Markets. Metro market Alfa market. Will allow Paul to present its product in their store. Local bakeries. The baker, Bread basket. Will buy from Paul its unique bread variety to offer in their store. School and University. American University Cairo , German School Cairo , British International School Cairo, German University Cairo French University Egypt , Le Collà ¨ge de la Mere de Dieu . Have agreed to deliver most of our sandwiches, desserts and beverages in their Cafeteria. Fitness centers and sport clubs. World gym, Golds gym and Platinum gym, will sell our healthy sandwiches and athletics meals. SWOT Analysis Strength Variety. Our customer has a wide range of varieties through which they can explore and try and not getting used to only one product. Price. Our products are in an affordable competing price according to the provided quality. Quality. Paul signed with the Ministry of Healths Terms of voluntary commitments nutritional progress under the Programme National Nutrition Santà © on all its products. Paul becomes the first brand of bakery and catering to obtain this recognition. Reputation. Paul has achieved an esteemed reputation throughout the years. Unique. Paul provides many unique products in the Egyptian market which can allow it to have a definite image between competitors which would help it to have the targeted market share. Weakness Brand Awareness. As a start up, Paul didnt yet establish an image or brand name in the local market. Whereas On the Run and other competitors have a strong image and national brand recognition. Culture Background. Most of our product comes from French background, thus it will take a little time for the Egyptian culture to explore and familiarize with it. Opportunities Paul can take advantage of two major market opportunities Lack in market. Egyptian market lacks most of the products that Paul would introduce. Increase demand. Egyptians demand to cafes with baked goods is growing rapidly. Threats Increased Competition. More bakeries and cafà ©s are entering the Egyptian market. With hundreds of them, Paul must stress out clear differentiation. Competitive pricing. Increased completion is pushing down the prices. Duration. Pauls products are all food based, thus it has to be sold during a short time period due to expiry and quality precautions. Objectives and Issues We have aggressive but reachable objectives during out first and second years of market entry. First year Objective. During the entrance of Paul for the first year in the Egyptian market, we are targeting for 20% share of Egyptian market. Second year Objective. We are aiming to achieve 30% of Egyptian market based on launching Paul restaurant and to achieve break even early in this period. Marketing Strategy Pauls marketing strategy mainly depends on positioning of product differentiation. Consumer target Primary consumer target. Adults and students which are considered upper to middle income individuals , who gathers around the tea-area in Paul and consumers more during their stay. Secondary Consumer Target. Athletes and healthy people, due to their demand for healthy and energetic food which contains high vitamins and nutrients that Egyptians market lacks. Tertiary Consumer Target. Children and seniors, as their needs would be little and met easily by mostly buying few products takeaway, like sweets, bread or desserts. Business Target Primary business target. Is mid to large sized Schools Universities. As there are large amount of students who can benefit from its presence at their location especially during their break or between lectures as well as their ability to buy such product. Fitness centers Sport Clubs. Can profit from the existence of our products, pre or post workout, which could allow them to maintain their training and diet. Positioning Through product differentiation, our product will position itself differently that other competitors. We will focus on high quality, unique taste and price added value. Product strategy Paul will be offering all the products reviewed in the earlier product review section during the first year. We will establish Paul restaurant which will be offering, Soups, Side dishes, Side sauce, big main dishes for Breakfast, Lunch Dinner as well as more menu variety from each category of the previous provided products. Building Pauls brand name that advocates high quality satisfaction is a crucial part of our strategy. The brand name PAUL will be printed on every bags and packaging to strengthen its entrance in the marketing promotion. Pricing Strategy Since Pauls products are new to this market, and due to high competition between prices; Paul will introduce its products in a lower price during the first year until Pauls restaurant is launched by the second year afterward an addition o 10% on Pauls product will take place to compensate the costs being paid to establish the restaurant and to allow further expansion to cover more parts of Egypt. Our First Year average prices will be as follows. Breakfast Plates ( 14 35 LE ) Quick lunch Plates ( 3 5 -56 L.E ) Sandwiches with the varieties ( 24.5 42 L.E ) Pies Pizzas ( 14 28 L.E ) Salads ( 24.5 38.5 L.E ) Grand classic breads ( 7- 10.5 L.E ) Pleasure breads ( 7- 35 L.E ) Light and healthy breads ( 10.5 35 L.E ) Athletic and Healthy meals ( 40 65 L.E ) Cakes and desserts ( 14- 28 L.E ) Ice creams ( 7- 14 L.E ) Viennoiseries and sweet pastries ( 5.6 14 L.E) Crepes ( 10.5- 17.5 L.E ) Fresh Juices , Hot cold drinks ( 7 21 L.E ) Take away boxes ( 70 L.E ) Distribution Strategy Pauls channel strategy is to use its store location as a primary tool to distribute its products and to rely secondly on well known supermarkets, local bakeries, schools, universities, fitness centers and sport clubs , and lastly on online orders. Marketing Organization Marketing Communication Strategy By combining and distributing all media messages simultaneously, we will fortify the brand name and the main points of product differentiation, especially out unique breads and desserts. Media campaign will be critical before and during product introduction. Therefore, advertising will appear on a rhythmic basis to maintain brand awareness and convey numerous differentiation messages. We would coordinate Public Relations efforts to develop Paul Brand name and support the differentiation message. We will as well offer limited time promotions, a listed item for customers that will buy a dessert, breads or other products will be offered without charge and further such promotions to attract market attention and favors purchasing. Paul will provide free samples on first one month, for its business targets, as well as it would set special trades deals for retailers that would place volume orders. We would as well rent booths in grand malls to demonstrate our products for first two weeks, we also will offer discounts for purchases that exceeds 150 L.E. Multimedia advertising campaign will take place; offers will be held with our partner radio stations, so that free gift coupons would be offered as a prize through them. Action Programs Paul will enter the Egyptian Market in September. The upcoming steps will summarize the action programs that will be taking place in the next six months. August We will begin with 400,000 L.E. sales promotion campaigns, to introduce the awareness of Paul to the local bakeries, schools and universities, fitness clubs and supermarket and also to generate excitement for Pauls entry on October. September Paul will be launched. Internet, Radio, and print campaign will take place, directed towards our business and customer targets. The campaign will show the products we offer, their quality, and that they are new and unique in Egypt. October As internet , Radio, Print multimedia campaigns persists , we will add consumer sales promotions , as offering promotions for large amount purchases , giving free item to consumers that buy desserts , breads and other products , as well as placing our booth in grand malls offering free samples. November We will distribute our products to schools, universities and supermarkets at this stage .Sales contest will be hold to offer prizes for sales person or one of our partners that offers our products, which had sold most out of our products. December Radio ads will put on celebrities taking about their experience trying Paul. Prints, television and internet ads will show celebrities eating a dessert from Paul. January We will offer out free coupons to our partner radio stations .we will place our products in local bakeries, fitness centers and sport clubs. Results of customer satisfaction survey will be counted and considered to make use of it in further promotions, and to review feedback of our products. Budgets The first Year sales profit is projected to be 20 million EGP. We predict the first year loss of 6 million EGP as there would be marketing budget not less than 1 million EGP plus the start up expenses of factory building , machinery , and staff hiring and training. Controls We are arranging a Very tight control measure with strong monitoring method to ensure customer satisfaction. That will allow us to respond very quickly in correcting any problems that may arise. Part 3

Drugs, Athletes, and Sports - Androstenedione :: Argumentative Persuasive Topics

Androstenedione: Just Say No Imagine rounding the bases after hitting your 70th home run and setting a new major league record. Slapping your teammatesí hands, you hear cheers progress throughout the sold out stadium. As you acknowledge the crowd further, you hear booing also coming from the standing crowd. Why are they booing? You just set a record! Then you see a small boy pointing at you and yelling. You watch closely and see the word, â€Å"Andro† form on his lips. Androstenedione, known as "andro", is made of a naturally occurring hormone of the body, which is used naturally in tiny amounts to make the male hormone testosterone. It is found in humans, animals and the pollen of many plants. Andro is produced in the gonads and adrenal glands of all mammals. It is said to help speed up the recovery of injuries along with bodybuilding and weight training to increase muscle mass. The androgens are the male sex steroids. When andro is taken it can convert the female sex steroid, estrogen into testosterone. Testosterone increases body and facial hair, acne, deepens the voice, enhances prostate growth, and promotes muscular growth. Blood levels of testosterone start rising about 15 minutes and peak about an hour after oral consumption of androstenedione. When users take too much, androgen shuts off the bodyís own making of testosterone, which can damage normal testicular function (Quinn). When athletes take androstenedione, it gives them an unfair advantage over other athletes. No one will ever know if Mark McGwire or any other athletes could have done their achievements without taking andro. "The International Olympics Committee, the National Collegiate Athletic Association, the National Football League, the National Basketball Association, and in the Men and Women's Tennis Tours banned androstenedione due to the fact that it is unsafe and gives an unfair advantage" (Totheroh). It is still legal, though, in Major League Baseball and the National Hockey League. If it is going to be banned in some sports, it should be banned in all. Since there are many different opinions of the committees, it is obvious that athletes are confused and are pushing the limits of performance improvements. People think that if androstenedione is not illegal then anyone should be allowed to take it. Mark McGwire used androstenedione and he set a world record. So is it safe to use? Should a high school athlete use it? Drugs, Athletes, and Sports - Androstenedione :: Argumentative Persuasive Topics Androstenedione: Just Say No Imagine rounding the bases after hitting your 70th home run and setting a new major league record. Slapping your teammatesí hands, you hear cheers progress throughout the sold out stadium. As you acknowledge the crowd further, you hear booing also coming from the standing crowd. Why are they booing? You just set a record! Then you see a small boy pointing at you and yelling. You watch closely and see the word, â€Å"Andro† form on his lips. Androstenedione, known as "andro", is made of a naturally occurring hormone of the body, which is used naturally in tiny amounts to make the male hormone testosterone. It is found in humans, animals and the pollen of many plants. Andro is produced in the gonads and adrenal glands of all mammals. It is said to help speed up the recovery of injuries along with bodybuilding and weight training to increase muscle mass. The androgens are the male sex steroids. When andro is taken it can convert the female sex steroid, estrogen into testosterone. Testosterone increases body and facial hair, acne, deepens the voice, enhances prostate growth, and promotes muscular growth. Blood levels of testosterone start rising about 15 minutes and peak about an hour after oral consumption of androstenedione. When users take too much, androgen shuts off the bodyís own making of testosterone, which can damage normal testicular function (Quinn). When athletes take androstenedione, it gives them an unfair advantage over other athletes. No one will ever know if Mark McGwire or any other athletes could have done their achievements without taking andro. "The International Olympics Committee, the National Collegiate Athletic Association, the National Football League, the National Basketball Association, and in the Men and Women's Tennis Tours banned androstenedione due to the fact that it is unsafe and gives an unfair advantage" (Totheroh). It is still legal, though, in Major League Baseball and the National Hockey League. If it is going to be banned in some sports, it should be banned in all. Since there are many different opinions of the committees, it is obvious that athletes are confused and are pushing the limits of performance improvements. People think that if androstenedione is not illegal then anyone should be allowed to take it. Mark McGwire used androstenedione and he set a world record. So is it safe to use? Should a high school athlete use it?

Comparing Dziga Vertovs Film, Man with a Movie Camera and Run Lola Run

Comparing Dziga Vertov's Film, Man with a Movie Camera and Run Lola Run " The main and essential thing is : the sensory exploration of the world through film. We therefore take as a point of departure the use of the camera as a keno-eye, more perfect than the human eye, for the exploration of the chaos of visual phenomena that fills space." - Dziga Vertov , Manifesto The Council of Three (1923) The innovative theories and filmmaking techniques of Dziga Vertov revolutionized the way films are made today. Man With a Movie Camera (1929), a documentary that represented the peak of the Soviet avant-garde film movement in the twenties, displayed techniques in montage, creative camera angles, rich imagery, but most importantly allowed him to express his theories of his writings of Kino-eye (the camera). The film has a very simple plot that describes an average day in Russia, yet the final pieces of this film emerge a complex and fast-paced production that excites the audience. Vertov's ability to use radical editing techniques with unconventional filming to present ordinary things has inspired many directors around the world. And still now modern avant-garde movies apply many of these same techniques to dramatize simple and complex stories. Vertov was one of the greatest innovators of Soviet cinema in the post WWI era. During this time, the freedom to make films was limited due to low stock of supply. Vertov and his colleagues had to be very creative and innovative if they were going produce anything at all. 'The Kuleshov Workshop', a workshop class at the Moscow Film School led by Lev Kuleshov included famous Soviet filmmakers like Vsevolod Pudovkin and Sergei Eisenstein, but excluded Vertov. This is significant to the ... ...ught to life these ideas on a new level in Run Lola Run, which glorifies the camera's results with movement in every frame. Run Lola Run feeds the kino-eye with collision, contrast, and conflicting scenes, which make the film a huge success in giving the audience a new type of story with suspense, comedy and drama. Works Cited Bordwell, David (1972a) Dziga Vertov: An Introduction. In: Film Comment 8,1, pp. 38-45 Denkin, H., "Linguistic Models in Early Soviet Cinema." Cinema Journal XVII / 1, Fall 77; p.1-Lynton, Norbert, The Story of Modern Art, Oxford: Phaidon Press Limited, 1980 Mast, Gerald, Kawin Bruce F., A Short History Of The Movies. Allyn & Bacon, 2000. Vertov, Dziga, Kino-eye: The Writings of Dziga Vertov / edited with an introduction by Annette Michelson; translated by Kevin O'Brien. Berkeley, CA.: University of California Press, c1984.